homepage Welcome to WebmasterWorld Guest from 184.72.82.126
register, free tools, login, search, pro membership, help, library, announcements, recent posts, open posts,
Become a Pro Member
Home / Forums Index / Code, Content, and Presentation / Perl Server Side CGI Scripting
Forum Library, Charter, Moderators: coopster & jatar k & phranque

Perl Server Side CGI Scripting Forum

    
perl programme
ojefua




msg:3785662
 2:58 pm on Nov 13, 2008 (gmt 0)

Hello,

I need to get subsequences from a long stretch of DNA sequence. The idea is to print out all possible subsequences beginning with (TTA¦CTA¦CTG¦TTG¦CTC) and ending with (TAG¦TGA¦TAA).
E.g; in a Dna like below:

$dna = "GGGCTACCCCGCCTCAAAGGGGGGTTACCCGGCCCGTTGAAACCCGGTCCGGGCTTAAAAGGGTAA"

only these subsequences can be obtained:

CTACCCCGCCTCAAAGGGGGGTTACCCGGCCCGTTGAAACCCGGTCCGGGCTTAAAAGGGTAA

CTCAAAGGGGGGTTACCCGGCCCGTTGAAACCCGGTCCGGGCTTAAAAGGGTAA

TTACCCGGCCCGTTGAAACCCGGTCCGGGCTTAAAAGGGTAA

TTAAAAGGGTAA

So, the point the subsequences are chopped of their positions in the DNA where there is any start codon and must end at the next stop codon(in this case there's only 1 stop codon "TAA")

 

phranque




msg:3787672
 4:09 am on Nov 17, 2008 (gmt 0)

welcome to WebmasterWorld [webmasterworld.com], ojefua!

please post your best effort for that code snippet so we can discuss the specific problem are you having with the code.

ojefua




msg:3789485
 8:12 am on Nov 19, 2008 (gmt 0)


Hi,

please check this for me.

my $seq = "AAAAATGAAAATAAGGGAAATGAAAAAAAAAAGGGGGGGACGGG"

my $gene = "AAATGAAAAAAA"

if I match gene from my sequence like so:

if($seq =~ /$gene/g){

#pos($seq) will give me 1st position after the match
#$` will hold the upstream sequence in this case:AAAAATGAAAATAAGGG

I am trying to find the position of the last stop codon in $` and assume that any of 3 possible stop codons are in the seq.

Notice the first 2 Adenines in the seq. It should be that the seq must be read in the correct frame as that of the match( In this case the frame should be 3rd frame; but we assume we dont know for some other sequence because this is just an eaxmple)

The correct position should return the position of TAA in the above

Global Options:
 top home search open messages active posts  
 

Home / Forums Index / Code, Content, and Presentation / Perl Server Side CGI Scripting
rss feed

All trademarks and copyrights held by respective owners. Member comments are owned by the poster.
Home ¦ Free Tools ¦ Terms of Service ¦ Privacy Policy ¦ Report Problem ¦ About ¦ Library ¦ Newsletter
WebmasterWorld is a Developer Shed Community owned by Jim Boykin.
© Webmaster World 1996-2014 all rights reserved